vincles familiars explorant vinculos familiares family links herencia heritance

Explorando los vínculos familiares

Explorando los vínculos familiares

De quién es hijo? Es esta sangre del asesino? ¿Cuáles son mis orígenes? Hablamos de cómo hemos respondido estas preguntas a lo largo del tiempo!

Todas las preguntas que acabamos de plantear las podemos sentir tanto en series como en las noticias. Normalmente van ligadas a casos judiciales por problemas de herencia, familiares perdidos o crímenes. Pero tienen algo en común? Pues sí, que a lo largo del tiempo las hemos respondido utilizando técnicas de biología clásica o molecular, como las que se usan en microbiología!

Hoy aparcamos los microorganismos y explicamos de manera muy gráfica en qué se basan diferentes métodos para estudiar relaciones biológicas.

Para entendernos en términos sencillos debemos partir de la base de que dos personas con vínculos familiares tienen determinadas características que han heredado una de la otra o de un antepasado común. Por lo tanto, elementos de su cuerpo (sangre, antígenos, DNA …) tendrán similitudes o diferencias que se aprovechan para sacar información.

Utilizaremos una cronología y viñetas de cómic para introducir a gran escala qué métodos han predominado en cada época :

1920 – Grupo sanguíneo

Sencillo pero con poco poder discriminativo. A partir de muestras de sangre se comparan los grupos (A, B, O, AB) de dos personas y se puede determinar la POSIBILIDAD que tengan una descendencia directa. Fuera de relaciones padre/madre-hij@, este método no es de mucha más utilidad, ya que sólo tenemos 4 opciones para combinar.

1930 – Antígenos del suero sangíneo

Tener en cuenta antígenos del suero sanguíneo añade algo de complejidad al test anterior. Se mira si los implicados tienen o no ciertos antígenos que se pueden detectar. Un ejemplo sería el antígeno Rh, que normalmente lo usamos conjuntamente con el grupo sanguíneo. En una persona de grupo sanguíneo «A», decimos que puede ser A+ o A- según si tiene el antígeno Rh o no. Recordad, el concepto de antígeno lo usamos para referirnos en este caso a partes únicas de una molécula que son reconocibles por el sistema inmunitario, y no tanto a un elemento extraño que entra al cuerpo. Podéis refrescar conceptos en este artículo de micronautes.

1970 – Antígenos de los leucocitos (HLA)

Los leucocitos son también llamados glóbulos blancos. Los encontramos en la sangre y son células del sistema inmunitario. HLA es el acrónimo en inglés de Antígeno de Leucocito Humano; y es que estudiando qué antígenos tienen nuestros leucocitos podemos discernir ya con mucho más detalle la genética entre dos personas.

Mientras que los tests de sangre y muchos de los basados ​​en antígenos no sirven para determinar una relación, sí son útiles para determinar la posibilidad biológica de la relación parental. A partir de los años 80 y hasta la actualidad, las técnicas basadas en DNA han sustituido todo lo demás, ya que ofrecen información mucho más resolutiva.

1980 – Polimorfismo de la longitud de los fragmentos de restricción (RFLP)

Consiste en comparar cómo queda el genoma de dos personas diferentes después de cortarlo en trozos pequeños. Se coge DNA de cada individuo y se corta utilizando enzimas de restricción, que son proteínas que cortan cuando hay una secuencia concreta que reconocen. Estas secuencias pueden encontrarse (o no) en el genoma y se utilizan diferentes enzimas vez para generar combinaciones de fragmentos diferentes. El número de fragmentos obtenidos y su tamaño dependerá del genoma original, por lo que los hijos conservarán patrones similares a la madre y al padre.

1990 – Reacción en cadena de la Polimerasa (PCR)

Esta técnica se basa en la capacidad de hacer copias del DNA de una región de interés. Podemos comparar a grandes rasgos si los genes que nos interesa son compartidos entre individuos porqué que una vez los hemos amplificado (muchas copias) son más fáciles de visualizar y detectar. La PCR es la técnica precursora en la que se basan las que veremos a posteriori y ha marcado un antes y un después en el campo de la biología molecular.

2000 – Polimorfismos en un único nucleótido (SNP)

Basándonos en la PCR y posterior secuenciación* podemos comparar secuencias de DNA de genes que normalmente son muy conservados a lo largo de la historia. Diferencias en nucleótidos únicos nos informan con una precisión altísima de la relación entre individuos.

2010 – Secuenciación de siguiente generación (NGS)

Este concepto hace referencia a la mejora tecnológica de los últimos años que nos ha permitido secuenciar a gran escala y precios muy reducidos. Actualmente es posible secuenciar de forma económica el genoma entero de los individuos para hacer una comparación del 100% de sus rasgos hereditarios!

* Ya hemos hablado varias veces de la secuenciación del ADN. El conocimiento esencial para entender el concepto es que el DNA está formado por moléculas que se diferencian por la variante de base nitrogenada que tienen. Secuenciar consiste en saber qué moléculas tenemos y en qué orden. Para facilitar su estudio asignamos una letra para representar cada base nitrogenada:

A – Adenina          T – Timina          G – Guanina          C – Citosina

Por eso, cuando tratamos con secuencias de DNA siempre vemos texto que aparentemente no tiene significado, como el siguiente:

ATGGAGCTGAGCTGGCACGTGGTGTTCATCGCCCTGCTGAGCTTCAGCTGCTGGGGCAGCGACTGGGAGAGCGACAGGAACTTCATC

Pero en realidad lo tiene! Este fragmento de ejemplo codifica para un pedazo de la enzima lactasa, que se encarga de digerir la lactosa.

 

Ya hemos visto que desde los años 80, el DNA es la base de todos los tests que se realizan. Pero donde se puede obtener y cómo podemos purificarlo?

DONDE? El DNA está presente en todas las células de nuestro cuerpo, vivas o muertas (como en el caso de células de descamación de la piel) siempre que mantengan la integridad. Lo más común es utilizar un escobillón y frotarlo entre la encía y las mejillas, pero también sirven para obtener el DNA de una persona:

  • Sangre
  • Dientes
  • Pelos con raíz
  • Recortes de uñas
  • Chicles usados
  • Colillas de cigarro
  • Cepillos de dientes
  • Caramelos lamidos
  • Pañuelos usados.

COMO? El primer paso siempre es lisar la célula (romper, en términos menos científicos) para que todo el contenido quede en suspensión. Después se puede recuperar el DNA o bien reteniendo en una membrana (como hacen la mayoría de kits comerciales) o precipitándose en alcohol u otros solventes orgánicos (método clásico) *.

https://upload.wikimedia.org/wikipedia/commons/thumb/9/99/DNA_Extraction.jpg/640px-DNA_Extraction.jpg
*Aunque puede ser muy laborioso cuando se requiere alta calidad del ADN, es muy sencillo y divertido intentar extraer el DNA en casa a partir de fruta. Os dejamos un vídeo por si os animáis!

Más datos y curiosidades…

En cuanto a los análisis de DNA, actualmente existe la posibilidad de estudiar el genoma de nuestros hijos incluso antes de que nazcan. Principalmente se hacen estudios para prever si puede haber síndrome de Down u otras enfermedades hereditarias, pero también existen algoritmos entrenados que pueden hacer predicciones de altura o capacidades cognitivas!

Si lo que queremos es cotillear sobre los precios, un test de paternidad actualmente cuesta alrededor de 350 € (IVA no incluido). Si es prenatal el precio asciende a los 1500 €. Secuenciar nuestro genoma entero también ha bajado por debajo de los 1000 €. Pese a las dudas de su fiabilidad, otros servicios disponibles que están ganando mucha popularidad son los tests para descubrir nuestros orígenes ancestrales por menos de 100 €.

Related image
Diferentes kits comerciales para el estudio de ancestros. Fuente: https://www.smarterhobby.com/genealogy/best-dna-test/

 

No hay que alarmarse pero … Antes de utilizar servicios comerciales relacionados con la caracterización de nuestro genoma, hay que leer bien las condiciones en cuanto al tratado de datos. Normalmente bajos precios que encontramos pueden venir dados a que el servicio está financiado y tus datos genéticos se venden a terceros.

 

 

Referencias

  • Tautz D. (1989). «Hypervariability of simple sequences as a general source for polymorphic DNA markers». Nucleic Acids Research. 17 (16): 6463–6471. doi:10.1093/nar/17.16.6463
  • Rerkamnuaychoke B1, Chantratita W, Jomsawat U, Thanakitgosate J, Rojanasunan P. Paternity testing by PCR-based STR analysis. J Med Assoc Thai. 2000 Mar;83 Suppl 1:S55-62.
  • G: Unnatural selection (Radiolab podcast): https://www.wnycstudios.org/story/g-unnatural-selection
  • https://family.findlaw.com/paternity/paternity-tests-blood-tests-and-dna.html
  • https://www.genome.gov/about-genomics/fact-sheets/Sequencing-Human-Genome-cost
  • https://www.businessinsider.es/dna-testing-delete-your-data-23andme-ancestry-2018-7?r=US&IR=T

Deja un comentario

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *