vincles familiars explorant vinculos familiares family links herencia heritance

Explorant els vincles familiars

Explorant els vincles familiars

De qui és fill? És aquesta sang de l’assassí? Quins són els meus orígens? Parlem de com hem respost al llarg del temps aquestes preguntes!

Totes les preguntes que acabem de plantejar les podem sentir tant a sèries com a les notícies. Normalment van lligades a casos judicials per problemes d’herència, familiars perduts o crims. Però tenen alguna cosa en comú? Doncs sí, que al llarg del temps les hem respost utilitzant tècniques de biologia clàssica o molecular, com les que s’usen en microbiologia!

Avui aparquem els microorganismes i expliquem de manera molt gràfica en què es basen diferents mètodes per estudiar relacions biològiques.

Per entendre’ns en termes senzills, hem de partir de la base que dues persones amb vincles familiars tenen determinades característiques que han heretat una de l’altre o d’un avantpassat comú. Per tant, elements del seu cos (sang, antígens, DNA…) tindran similituds o diferències que s’aprofiten per treure informació.

Utilitzarem una cronologia per introduir a gran escala quins mètodes han predominat a cada època i vinyetes de còmic per veure cada exemple:

herència sang dna era antigens grup sanguini leucocits hla rflp snp dna ngs pcr

1920 – Grup sanguini

Senzill però amb poc poder discriminatiu. A partir de mostres de sang es comparen els grups (A, B, O, AB) de dues persones i es pot determinar la POSSIBILITAT que tinguin una descendència directa. Fora de relacions pare/mare-fill/a, aquest mètode no era de gaire més utilitat, ja que només tenim 4 opcions per combinar.

1930 – Antígens al sèrum de la sang

Tenir en compte antígens al sèrum sanguini afegeix una mica de complexitat al test anterior. Es mira si els implicats tenen o no certs antígens que es poden detectar. Un exemple seria l’antigen Rh,  que normalment el fem servir conjuntament amb el grup sanguini. En una persona de grup sanguini “A”, diem que pot ser A+ o A- segons si té l’antigen Rh o no. Recordeu, el concepte d’antigen el fem servir per referir-nos en aquest cas a parts úniques d’una molècula que són reconeixibles pel sistema immunitari, i no tant a un element estrany que entra al cos. Podeu refrescar conceptes en aquest article de micronautes.

1970 – Antígens als leucòcits (HLA)

Els leucòcits són també anomenats glòbuls blancs. Els trobem a la sang i són cèl·lules del sistema immunitari. HLA és l’acrònim en anglès d’Antigen de Leucòcit Humà; i és que estudiant quins antígens tenen els nostres leucòcits podem discernir ja amb molt més detall la genètica entre dues persones.

Mentre que els tests de sang i molts dels basats en antígens no serveixen per determinar una relació, sí que són útils per determinar la possibilitat biològica de la relació parental. A partir dels anys 80 i  fins a l’actualitat, les tècniques basades en DNA han substituït tota la resta, ja que ofereixen informació molt més resolutiva.

 

1980 – Polimorfisme de la llargada dels fragments de restricció (RFLP)

Consisteix a comparar com queda el genoma de dues persones diferents després de tallar-lo en trossets petits. S’agafa DNA de cada individu i es talla utilitzant enzims de restricció, que són proteïnes que tallen quan hi ha una seqüència concreta que reconeixen. Aquestes seqüències poden trobar-se (o no) al genoma i es fan servir diferents enzims alhora per generar combinacions de fragments diferents. El nombre de fragments obtinguts i la seva mida dependrà del genoma original, i per això els fills conservaran patrons similars a la mare i al pare.

1990 – Reacció en cadena de la Polimerasa (PCR)

Aquesta tècnica es basa en la capacitat de fer còpies del DNA d’una regió d’interès. Podem comparar a grans trets si els gens que ens interessa són compartits entre individus, ja que un cop els hem amplificat molt (moltes còpies) són més fàcils de visualitzar i detectar. La PCR és la tècnica precursora en la qual es basen les que veurem a posteriori i ha marcat un abans i un després al camp de la biologia molecular.

 

2000 – Polimorfismes en un únic nucleòtid (SNP)

Basant-nos en la PCR i posterior seqüenciació* podem comparar seqüències de DNA de gens que normalment són molt conservats al llarg de la història. Diferències en nucleòtids únics ens informen amb una precisió altíssima de la relació entre individus.

*Ja hem parlat diversos cops de la seqüenciació del DNA. El coneixement essencial per entendre el concepte és que el DNA està format per molècules que es diferencien per la variant de base nitrogenada que tenen. Seqüenciar consisteix en saber quines molècules tenim i en quin ordre. Per facilitar el seu estudi assignem una lletra per representar cada base nitrogenada:

  • A – Adenina
  • T – Timina
  • G – Guanina
  • C – Citosina

Per això, quan tractem amb seqüències de DNA sempre veiem text que aparentment no té significat, com el següent: ATGGAGCTGAGCTGGCACGTGGTGTTCATCGCCCTGCTGAGCTTCAGCTGCTGGGGCAGCGACTGGGAGAGCGACAGGAACTTCATCAGCACCGCCG
Però en realitat el té! Aquest fragment d’exemple codifica per un tros de l’enzim lactasa, que s’encarrega de digerir la lactosa.

2010 – Seqüenciació de pròxima generació (NGS)

Aquest concepte fa referència a la millora tecnològica dels darrers anys que ens ha permès seqüenciar a gran escala i preus molt reduïts. Actualment és possible seqüenciar d’una manera econòmica el genoma sencer dels individus per fer una comparació del 100% dels seus trets hereditaris!

 

Ja hem vist que des dels anys 80, el DNA és la base de tots els tests que es realitzen. Però d’on es pot obtenir i com el podem purificar?

ON? El DNA és present a totes les cèl·lules del nostre cos, vives o mortes (com en el cas de cèl·lules de descamació de la pell) sempre que mantinguin la integritat. El més comú és utilitzar un escovilló i fregar-lo entre la geniva i les galtes, però també serveixen per obtenir el DNA d’una persona la sang, dents, pèls amb arrel, retalls d’ungles, xiclets, burilles, raspalls de dents, caramels llepats o mocadors usats.

COM? El primer pas sempre és llisar la cèl·lula (trencar, en termes menys científics) perquè tot el contingut quedi en suspensió. Després es pot recuperar el DNA o bé retenint-lo en una membrana (com fan la majoria de kits comercials) o precipitant-lo en alcohol o altres solvents orgànics (mètode clàssic)*.

https://upload.wikimedia.org/wikipedia/commons/thumb/9/99/DNA_Extraction.jpg/640px-DNA_Extraction.jpg
* Tot i que pot ser molt laboriós quan es requereix alta qualitat del DNA, és molt senzill i divertit provar d’extreure el DNA a casa a partir de fruita! Us deixem un vídeo perquè ho veieu i proveu vosaltres mateixos, només necessitareu fruita, sabó i alcohol.

Més dades i curiositats…

Pel que fa a les anàlisis de DNA, actualment existeix la possibilitat d’estudiar el genoma dels nostres fills fins i tot abans que neixin. Principalment es fan estudis per preveure si pot haver-hi síndrome de Down o altres malalties hereditàries, però també existeixen algoritmes entrenats que poden fer estimes d’alçada o capacitats cognitives!

Si el que volem és xafardejar sobre els preus, un test de paternitat actualment ronda els 350€ (IVA no inclòs). Si és prenatal el preu ascendeix als 1500€. Seqüenciar el nostre genoma sencer també ha baixat per sota dels 1000€. Altres serveis que estan guanyant molta popularitat malgrat els dubtes de la seva fiabilitat són els tests per descobrir els nostres orígens ancestrals. Els trobem disponibles per menys de 100€.

Related image
Diferents kits comercials per l’estudi d’ancestres. Font: https://www.smarterhobby.com/genealogy/best-dna-test/

No cal alarmar-se però… Abans d’utilitzar serveis comercials relacionats amb la caracterització del nostre genoma, cal que llegim bé les condicions pel que fa al tractat de dades. Normalment baixos preus que trobem poden venir donats a què el servei està finançat i les teves dades genètiques es venen a tercers.

 

 

Referències

  • Tautz D. (1989). “Hypervariability of simple sequences as a general source for polymorphic DNA markers”. Nucleic Acids Research. 17 (16): 6463–6471. doi:10.1093/nar/17.16.6463
  • Rerkamnuaychoke B1, Chantratita W, Jomsawat U, Thanakitgosate J, Rojanasunan P. Paternity testing by PCR-based STR analysis. J Med Assoc Thai. 2000 Mar;83 Suppl 1:S55-62.
  • G: Unnatural selection (Radiolab podcast): https://www.wnycstudios.org/story/g-unnatural-selection
  • https://family.findlaw.com/paternity/paternity-tests-blood-tests-and-dna.html
  • https://www.genome.gov/about-genomics/fact-sheets/Sequencing-Human-Genome-cost
  • https://www.businessinsider.es/dna-testing-delete-your-data-23andme-ancestry-2018-7?r=US&IR=T

 

Deixa un comentari

L'adreça electrònica no es publicarà. Els camps necessaris estan marcats amb *