vincles familiars explorant vinculos familiares family links herencia heritance

Exploring family bonds!

Exploring family bonds!

Who is the father? Is this blood of the killer? What are my origins? Let’s talk about how we’ve answered these questions through years!

All the questions that we have just posed can be heard both in series and in the news. They are usually linked to legal cases due to inheritance problems, lost relatives, or crimes. But do they have something in common? Yes! Over time we have answered them using classical or molecular biology techniques, such as those used in microbiology!

Today we set aside microbes and we’ll show in a graphical way which methods have been used to study biological relations.

In simple terms, two related individuals will have inherited certain traits from one another or a common ancestor. Thus, elements from their body (blood, antigens, DNA…) will have similarities or differences that can be used to extract information.

We will use a chronology and comic stripes to introduce in general terms which methods have prevailed along years:

1920 – Blood group

Simple test but with little discriminative power. From blood samples, the groups (A, B, O, AB) of two people are compared and the POSSIBILITY of having a direct relationship can be determined. Outside of parent-child relationship, this method was not much more useful, since we only have 4 options to combine.

1930 – Blood serum antigens

Taking into account antigens in blood serum adds some complexity to the previous test. We check whether the two individuals have certain antigens that can be detected. An example would be the Rh antigen, which we usually use in conjunction with the blood group. We say a person of blood group “A” can be either A+ or A- according to whether it has the Rh antigen or not. Remember, the concept of antigen is used to refer herein to unique parts of a molecule that are recognizable by the immune system, and not to a strange element that enters the body. You can refresh concepts in this article.

1970 – Human Leukocyte Antigens (HLA)

Leukocytes are also known as white blood cells. We find them in the blood and they are part of the immune system. By studying which antigens our leukocytes have, we can already discern in much more detail genetics between two people.

While blood or antigen-based tests do not serve to determine a relationship, they are useful for determining the biological possibility of parental relationship. Since the 80’s and up to now, DNA-based techniques have replaced all the rest, since they offer much more resolute information.

1980 – Restriction Fragment Lenght Polimorphysm (RFLP)

Consisteix a comparar com queda el genoma de dues persones diferents després de tallar-lo en trossets petits. S’agafa DNA de cada individu i es talla utilitzant enzims de restricció, que són proteïnes que tallen quan hi ha una seqüència concreta que reconeixen. Aquestes seqüències poden trobar-se (o no) al genoma i es fan servir diferents enzims alhora per generar combinacions de fragments diferents. El nombre de fragments obtinguts i la seva mida dependrà del genoma original, i per això els fills conservaran patrons similars a la mare i al pare.

1990 – Reacció en cadena de la Polimerasa (PCR)

Aquesta tècnica es basa en la capacitat de fer còpies del DNA d’una regió d’interès. Podem comparar a grans trets si els gens que ens interessa són compartits entre individus, ja que un cop els hem amplificat molt (moltes còpies) són més fàcils de visualitzar i detectar. La PCR és la tècnica precursora en la qual es basen les que veurem a posteriori i ha marcat un abans i un després al camp de la biologia molecular.

 

2000 – Polimorfismes en un únic nucleòtid (SNP)

Basant-nos en la PCR i posterior seqüenciació* podem comparar seqüències de DNA de gens que normalment són molt conservats al llarg de la història. Diferències en nucleòtids únics ens informen amb una precisió altíssima de la relació entre individus.

*Ja hem parlat diversos cops de la seqüenciació del DNA. El coneixement essencial per entendre el concepte és que el DNA està format per molècules que es diferencien per la variant de base nitrogenada que tenen. Seqüenciar consisteix en saber quines molècules tenim i en quin ordre. Per facilitar el seu estudi assignem una lletra per representar cada base nitrogenada:

  • A – Adenina
  • T – Timina
  • G – Guanina
  • C – Citosina

Per això, quan tractem amb seqüències de DNA sempre veiem text que aparentment no té significat, com el següent: ATGGAGCTGAGCTGGCACGTGGTGTTCATCGCCCTGCTGAGCTTCAGCTGCTGGGGCAGCGACTGGGAGAGCGACAGGAACTTCATCAGCACCGCCG
Però en realitat el té! Aquest fragment d’exemple codifica per un tros de l’enzim lactasa, que s’encarrega de digerir la lactosa.

2010 – Seqüenciació de pròxima generació (NGS)

Aquest concepte fa referència a la millora tecnològica dels darrers anys que ens ha permès seqüenciar a gran escala i preus molt reduïts. Actualment és possible seqüenciar d’una manera econòmica el genoma sencer dels individus per fer una comparació del 100% dels seus trets hereditaris!

 

Ja hem vist que des dels anys 80, el DNA és la base de tots els tests que es realitzen. Però d’on es pot obtenir i com el podem purificar?

ON? El DNA és present a totes les cèl·lules del nostre cos, vives o mortes (com en el cas de cèl·lules de descamació de la pell) sempre que mantinguin la integritat. El més comú és utilitzar un escovilló i fregar-lo entre la geniva i les galtes, però també serveixen per obtenir el DNA d’una persona la sang, dents, pèls amb arrel, retalls d’ungles, xiclets, burilles, raspalls de dents, caramels llepats o mocadors usats.

COM? El primer pas sempre és llisar la cèl·lula (trencar, en termes menys científics) perquè tot el contingut quedi en suspensió. Després es pot recuperar el DNA o bé retenint-lo en una membrana (com fan la majoria de kits comercials) o precipitant-lo en alcohol o altres solvents orgànics (mètode clàssic)*.

https://upload.wikimedia.org/wikipedia/commons/thumb/9/99/DNA_Extraction.jpg/640px-DNA_Extraction.jpg
* Tot i que pot ser molt laboriós quan es requereix alta qualitat del DNA, és molt senzill i divertit provar d’extreure el DNA a casa a partir de fruita! Us deixem un vídeo perquè ho veieu i proveu vosaltres mateixos, només necessitareu fruita, sabó i alcohol.

Més dades i curiositats…

Pel que fa a les anàlisis de DNA, actualment existeix la possibilitat d’estudiar el genoma dels nostres fills fins i tot abans que neixin. Principalment es fan estudis per preveure si pot haver-hi síndrome de Down o altres malalties hereditàries, però també existeixen algoritmes entrenats que poden fer estimes d’alçada o capacitats cognitives!

Si el que volem és xafardejar sobre els preus, un test de paternitat actualment ronda els 350€ (IVA no inclòs). Si és prenatal el preu ascendeix als 1500€. Seqüenciar el nostre genoma sencer també ha baixat per sota dels 1000€. Altres serveis que estan guanyant molta popularitat malgrat els dubtes de la seva fiabilitat són els tests per descobrir els nostres orígens ancestrals. Els trobem disponibles per menys de 100€.

Related image
Diferents kits comercials per l’estudi d’ancestres. Font: https://www.smarterhobby.com/genealogy/best-dna-test/

No cal alarmar-se però… Abans d’utilitzar serveis comercials relacionats amb la caracterització del nostre genoma, cal que llegim bé les condicions pel que fa al tractat de dades. Normalment baixos preus que trobem poden venir donats a què el servei està finançat i les teves dades genètiques es venen a tercers.

 

 

Referències

  • Tautz D. (1989). “Hypervariability of simple sequences as a general source for polymorphic DNA markers”. Nucleic Acids Research. 17 (16): 6463–6471. doi:10.1093/nar/17.16.6463
  • Rerkamnuaychoke B1, Chantratita W, Jomsawat U, Thanakitgosate J, Rojanasunan P. Paternity testing by PCR-based STR analysis. J Med Assoc Thai. 2000 Mar;83 Suppl 1:S55-62.
  • G: Unnatural selection (Radiolab podcast): https://www.wnycstudios.org/story/g-unnatural-selection
  • https://family.findlaw.com/paternity/paternity-tests-blood-tests-and-dna.html
  • https://www.genome.gov/about-genomics/fact-sheets/Sequencing-Human-Genome-cost
  • https://www.businessinsider.es/dna-testing-delete-your-data-23andme-ancestry-2018-7?r=US&IR=T

 

Leave a Reply

Your email address will not be published. Required fields are marked *